2021/08/09 16:30:01
Welcome to the ‘Moveable Feast Cafe’. The ‘Moveable Feast’ is an open thread where readers can post wide ranging observations, articles, rants, off topic and have animate discussions of the issues of the day.
The ‘Moveable Feast Cafe’ will have two new open threads each week.
The Saker stated moderation policy will apply eg ‘no caps’, no obscenity … etc to all post.
The Cafe is now open for business … come on in and have a good time.
Saker Webmaster
Leave a Reply --Link to Moderation Policy--
Only Logged in users can comment.
New Commentators Register here to comment.
Quote:
http://thesaker.is/moveable-feast-cafe-2021-08-06/#comment-963238
sean the leprechaun on August 09, 2021 · at 10:42 am EST/EDT
I enjoyed the, simple as it may have been for us lay folk, explanation of how the human immune system used to work, like we were taught in high school biology.
End Quote
That Sean, in a nutshell, is the problem. Dig deeper:
http://philosophers-stone.info/wp-content/uploads/2020/11/The-scam-has-been-confirmed-Dsalud-November-2020.pdf
…[]…
The question we asked ourselves then was: if the sequences that have been published do not belong – as claimed- to new viruses, where do they come from? And to try to answer that question we decided to carry out a search with a computer program called Basic Local Alignment Search Tool (BLAST), a sequence alignment search tool that allows us to compare a given sequence with all the sequences stored in the National Institutes of Health of the United States (it is public and can be consulted at https://blast.ncbi.nlm.nih.gov/Blast.cgi. We explain step by step what we did so that our readers can repeat the search for themselves and check the results.
First we collected all the initiators of the PCRs described in the protocols hosted on the WHO website at the time which were these:
– China CDC protocol: uses ORF1ab and N genes as target.
– Protocol of the Pasteur Institute (France): uses two fragments of the RdRP (which is supposed to be SARS.CoV-2 specific).
– United States CDC protocol: uses three fragments of the N gene.
– Protocol of the National Institute of Infectious Diseases of Japan: it is the only one that has as target the S gene together with other genes supposedly shared with other coronaviruses.
– Charite Protocol (Germany): uses the E, N and RdRP genes.
– Hong Kong University Protocol: uses ORF1b-nsp14 and N gene.
– National Institute of Health Thailand protocol: uses the N gene.
We then introduced the sequence of the primers – the one that indicates the beginning of the sequence to be detected (forward) and the one that indicates the final (reverse) – into the BLAST so that it could search for them in two databases: a collection of microbe genomes and the one corresponding to the human genome.
THE SEQUENCES OF THE SO-CALLED SARS-COV-2 ARE FOUND BOTH IN HUMANS AND IN NUMEROUS MICROBES!
Let’s see in detail the procedure taking as an example the initiators of the French protocol. Once on the BLAST website, we chose Microbes to search the microbial genome databases and moved to the next page. Then a form appeared in which we entered the sequence of the forward initiator of the French protocol -that is ATGAGCTTAGTCCTGTG-, we selected the option Highly similar sequences and pressed the BLAST key. Just a few seconds later the results appeared -we took a screenshot (image 1)- and we were shown 100 sequences of microbes -particularly bacteria and archaea- with a coincidence of between 77% and 100% with an identity percentage of 100%.
We then returned to the home page and that second time we chose Human to search the human genome, we repeated the same operation and after a few seconds the result appeared which we screen captured again (image 2). And it turns out that the sequence entered coincides with 74 sequences of the human genome, with a coincidence of between 66% and 100% and a percentage of identity of 100%. And that indicates that the sequence of that initial PCR primer that is supposed to be specific to SARS-CoV-2 actually corresponds to 74 fragments of the human genome and a hundred microbial fragments as well!
We then decided to repeat the operation but with the final or reverse primer – which is CTCCCTTTGTGTGTGT – and the results were similar.
Since these were very short sequences -about twenty genetic letters or nucleotides- we decided to try again but with the target sequence defined by these two primers, i.e. the sequence of the supposed SARS-CoV-2 genome that is between the initial primer and the final primer. Obviously, for this we needed the sequence that is officially claimed to be the “SARS-CoV-2 genome” and although thousands of laboratories claim to have isolated and sequenced it -a false claim as we have explained in previous reports- we decided to go to the National Centre for Biotechnology Information website: https://www.ncbi.nlm.nih.gov/nuccore/NC_045512.2?
report=genbank&to=29903. Once there, we located the “target sequence”, a fragment of 108 nucleotides located between positions 12,690 and 12,797 of the “genome”, which is this one:
ATGAGCTTAGTCCTGTTGCACTACGACAGATGTTGTGCCGGTACACAAACTGCTTGCACTGAT
GACAATGCGTTAGCTTACAACAACAAAGGGAG.
With this we repeated the steps previously described and the results were again surprising since there appeared again a hundred microbe sequences with a percentage of a match of 100% and four sequences of the human genome with an identity percentage between 83% and 95%. The matches were therefore lower but the important thing is that we continue to find fragments of the supposed “target sequence” of SARS-CoV-2 both in microbes and in our own genome.
Truly astonished we took a further step and tested with the gene considered at that time as the most specific of SARS-CoV-2, the E gene that is supposed to generate the envelope proteins and is located between positions 26,245 and 26,472:
ATGTACTCATTCGTTTCGGAAGAGACAGGTACTACGTTAATAGTTAATAGCGTACTTCTCTTGCT
TTCGTGGTATTCTTGCTAGTTACACTAGCCATCCTGCTTCGATTGTGCGTACTGCTGCAATATTG
TTAACGTGAGTCTTGTAAAACCTTTACGTTTACTCGTGTTAAAATCTGAATTCTTCTAGAGTTCG
ATTCTGGTCTAA.
We repeated with it the steps already described and the result was even more surprising because despite its length another hundred microbe sequences appeared with a percentage of identity of 100% and 10 sequences of the human genome with a percentage of identity between 80% and 100%. And similar results were obtained with a fragment chosen at random and with the N gene which they say corresponds to the proteins of the SARS-CoV-2 nucleocapsid.
We finally decided to test with the S gene which is said to generate the structural “spike” proteins that are key to entry into the cell and was subsequently considered to be the most specific SARSCoV-2 gene. Since it is a gene whose sequence is much longer – 3821 nucleotides between positions 21,563 and 25,384 – we tested with two fragments chosen at random within that gene and the first – TTGGCAAAATTCAAGACTCACTTTC – resulted in another hundred microbe sequences and 93 sequences of the human genome and the second –
CTTGCTGCTACTAAATGCAGAGTGT – a hundred microbial sequences and 90 of the human
genome.
Finally we decided to test with the initiators of the Japan Protocol, the only one that includes target sequences of the S gene and, the reader will have already guessed, the results were once again similar: a hundred microbe sequences and 93 sequences of the human genome with an identity percentage between 94.12% and 100%!
CONCLUSIONS
The consequence of all that we have just explained is clear and immediate: THERE IS NO VALID TEST TO DETECT SARS-COV-2, neither antibody or antigen tests nor RT-PCR. And we included those based on the supposed gene that codes for the S1 or spike protein. And that means that ALL THE NUMBERS OF “CASES”, “INFECTED”, “SICK”, “Asymptomatic” OR “DEAD DUE TO COVID-19” LACK A SCIENTIFIC BASE AND ALL “POSITIVES” ARE FALSE POSITIVES, something that should be communicated immediately to those affected and those responsible should be held accountable.
Sean,
it appears this is the last day for rational discussion.
Follow the BLAST steps for yourself – you can use the web version without installing the API:
https://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome
Hello everybody!
Can anyone to give a reasonable hypothesis to explain that Elon Musk was not invited to the White House meeting with Biden on August 5, which concerned electric cars?
https://www.zerohedge.com/markets/biden-administration-targets-50-entire-auto-fleet-be-electric-2030
It is clear that this meeting is not about cars, there are other elite conversations and to split the pot. But I thought Musk was their guy. A guy from a group of global financiers, like Biden. For example, Musk is definitely not a Trump supporter. And now he is not invited. How do you understand this? Does he belong to the third power group – conditional Digital and the Media – like Dorsey, Zuckerberg, etc., against whom Biden is also fighting as against Trumpists too?
The non-invitation was a public action – that is, it is a signal to certain power group.
How we can to decipher that signal?
In general, I hope for your reasoned explanation of the phenomenon of Musk’s absence at the White House electric vehicles meeting.
you think elon musk is in the electric vehicle business?
Yep, I do :)
I found that one does not get invited when one is about to tell the interested party’s things they do not want to hear.
Thanks. This is an elegant version :)
I did my Ph.D. research in sustainable vehicle transitions.
They are impossible, barring a major, drastic reduction in private vehicle usage. Private vehicle ownership is the basis of much of the infrastructure in the US. There is no way to run public transit into the low density residential areas that Americans have become accustomed to.
When Biden says he wants to make EVs 50% of the new vehicle fleet in 2030 he is saying he wants to drastically reduce new vehicle sales in the US. Think about it, we are at 2% new electric vehicles in 2020 ( and actually declining in market share). If we can increase that by 100% a year, against todays production, for ten years, that’s 20% of the market.
If a 20% EV market share is 50% of the entire market, that means we are only producing 40% of the vehicles we are producing today.
Now consider that EV’s have, and always will have, higher costs than the alternative drivetrains due to the expense of large batteries. Batteries are large boxes of semi-rare minerals. There is no way around that economically or technically. The more batteries we produce the more rare and expensive those minerals become to make them.
Wealthier people can afford EVs, and may even see long term economic benefit from owning them due to lower fuel costs. But people with lesser means cannot afford the high buy in cost of the EV, preferring to pay, perhaps, more for the fuel on ongoing basis. However, they can control their fuel expenses by choosing to reduce driving when fuel is expensive. With an EV, you are locked into the initial vehicle cost.
Unfortunately, much of the various New Green Deal schemes only work with a drastically reduced world population. I don’t understand why Green energy advocates like Bill Gates fought Covid so furiously when it may have been precisely the antidote necessary to the population problem that frustrates the Green Agenda.
Very interesting analysis and calculations. Reduction of production and sales of new vehicles… Fact stands before eyes… But until you paid attention to this fact, I did not think about this feature. Many fans of electric cars too, I suppose. Thanks.
It is all go against Belarus
https://www.rt.com/russia/531550-belarus-sanctions-biden-tikhanovskaya/
And
1 CRISIS IN BELARUS 9 AUG, 15:26 European Parliament calls on EU to prepare revolution in Belarus The deputies offered to implement the scenario of a change of power in Belarus similar to the Ukrainian one European Parliament © Kiev.Victor/Shutterstock/FOTODOM BRUSSELS, August 9. / TASS /. The European Parliament’s largest faction, the conservative European People’s Party (EPP), on Monday urged the EU to prepare a revolution in Belarus, noting that “the Belarusian regime will fall.” The EPP proposed to show readiness to “punish the regime” by imposing sanctions as well as to “support the ongoing struggle of the people of Belarus.” “The regime will fall and the victory of the Belarusian people is inevitable, it is only a question of time. The European Union must prepare for the victory of the democratic revolution,” the faction’ leader Manfred Weber stated on Monday in Brussels ahead of the first anniversary of the last presidential elections in Belarus. The deputies offered to implement the scenario of a change of power in Belarus similar to the Ukrainian one. Furthermore, they called for the prosecution of President Alexander Lukashenko and leading government authorities as part of “future democratic reforms.” The Members of the European Parliament (MEPs) mentioned that they supported “the plan for substantial economic assistance worth 3 bln euros, unveiled by the European Commission.” However, the MEPs noted that the EU’s efforts to change the government in Minsk should not be limited to financial initiatives. “Belarus will need not just money. It will require a comprehensive masterplan to support the adoption of democratic reforms on all levels of government, national, regional and local, which have to go hand in hand with deep economic reforms. The European Union is well equipped [for this task] thanks to the experience accumulated with the transitions in Central and Eastern European, and Western Balkan countries, and most recently in the three Eastern Partnership association countries (Ukraine, Georgia and Moldova),” the statement reads. The MEPs also proposed, in order to inflame the protest moods, to expand work with Belarusian youth, providing them with the opportunity to study at the EU countries’ universities to promote the ideals of “freedom and democracy.” Also, the deputies called on the international legitimization of the Belarusian opposition located abroad led by ex-presidential candidate Svetlana Tikhanovskaya as well as to actively promote the work of opposition non-governmental organizations in the republic. “We will not rest our efforts until democracy is restored in Belarus,” the MEPs concluded. “
Haha, what utter tosh.
The entire proclamation above reads like the “background information” part of a very promising job advertisement. Problem is: Lukashenko, his Belarusian compatriots, Putin, and the Secret Services of Belarus and Russia have proven beyond reasonable doubt that the regime change srunts courtesy of Soros and the Euro-trash are totally wasted efforts. They did take Ukraine, which will soon be annexed into the Russian Federation once the depopulation of Banderastan has progressed far enough. Still, I’m 100% certain the clowns that are to be entrusted with this noble, yet futile, endeavour are to be handsomely remunerated. Easy money for monumental flopping. Will Gównopolska and Lithuania serve as the staging ground?
The United States government has been given limited permission to appeal the District Court’s decision to block the extradition of Julian Assange from the UK to the U.S. Britain’s High Court ruled that the U.S. government could appeal on some but not all of their requested points. Now a preliminary hearing has been scheduled for August 11th, at the Royal Courts of Justice in London, to argue the scope of that appeal, and whether the U.S. government will be allowed to appeal on its other two proposed lines of argument. Assange is expected to attend in person. Following that hearing, the High Court will schedule a date to hear full appeal arguments.
Exquisitely timed for when Craig Murray is incarcerated.
Months ago Putin condemned the bombings of Hiroshima and Nagasaki as war crimes. I wouldn’t be surprised if the rest of the Russian govt. joined him in it, unless they did that already, but I certainly remember seeing articles in the Russian media doing it too (one such article even mentions the USA’s monopoly in the world media, and henceforth the war narrative, as a contributor to the fallacy of the bombings being ‘necessary’ and/or ‘just’. what a contrast the Russian MSM (SMI?) makes with a portion of the commentariat on this article!)
The Iranian government took it upon itself to do just that as well.
https://www.rt.com/news/531461-iran-blasts-us-hiroshima/
Now it’s China’s turn. President Xi, where are you?
china started it then rus and iran followed
Glad to see there is at least some authority in China besides Mao Zedong that sees the bombing of Hiroshima and Nagasaki as war crimes.
How much longer does one reckon it’ll take until citizens in China and/or Russia stop rejoicing the bombings, advocating that more bombs be dropped, etc. and realize that the USA (having had anti-Russian and anti-Chinese agendas under its belt within the course of the bombings) is not their friend? (Or at least see the bombings in the context of other USian war crimes like in Iraq, Syria, Lybia, etc.?)
In seriousness, I’ll go out on a limb and assume, unless proven otherwise, that those netizens who rejoice the bombings (e.g. this one) are a vocal minority, whereas those who condemn the bombings (even while keeping in mind bitter, painful memories of atrocities committed by Japanese troops) are part of a silent majority. Seeing the former camp on even an anime/ACG-oriented site like Bilibili left me a bad taste in my mouth and made me decide to take a break from perusing the Chinese internet, and now I have yet to be sure of when it’s safe to visit again without impairing my mental health.
(On another note, seriously, what good comes out of an education that lumps a national people and its ruling elites together?)
”How much longer does one reckon it’ll take until citizens in China and/or Russia stop rejoicing the bombings”
It may happen quite soon Once the ”woke” standpoint becomes that nuclear attacks are indefensible, the West will instantly start blaming Russia either for carrying out the nuclear attacks outright or for deceiving the Pindos to carry them out. In other words, Russia will have to apologize (till the end of time) both for having started WW2 along with Nazi Germany and also for having caused instant nuclear hell in Japan at the very end of the war.
On second thought, would it not be sweet revenge to nuke Pindos and Euro-trash based upon the tender, beautiful statement of Bill Kristol’s:
What’s the good of nuclear weapons if you can’t use them?
Did I leave out that Iran called for denuclearization? Or that Putin condemned the nukings? How is that “woke”? Is it not already “woke” for the USA to rationalize the bombings as some sort of ‘live-saving measure’ and/or to neglect the Soviets’ role in defeating the Japanese army and causing them to surrender?
All I know is, nuclear disembowelment of non-combatants is wrong no matter the nationality of the perpetrators or the victims. Something Kristol has yet to absorb.
”Or that Putin condemned the nukings? How is that ’woke’ ?”
The problem here was that there are ordinary people in the resistance countries who celebrate the nuking by the US of Hiroshima and Nagasaki — as if that would matter at all to the omnicidal swine and scum who haven’t become more peaceful since; just the opposite.
Those citizens in Russia who think the US was entitled to nuke Japan might reconsider when the Western WW2 ”narrative” starts accusing Stalin for having nuked Japan and that, therefore, Russia has to be punished severely. They had already concocted plans in 1945 ”to that effect”, so to speak. Why not dust these plans off again based upon some ingenious ’woke’ mumbo-jumbo? Putin, just like his colleagues in China and Iran, will of course never sputter any braindead wokish, least of all based upon Russophobia. But Putin certainly will ”take action” once Russia’s survival demands it. At that point, the famous words of Bill Kristol’s might seem apt to ’make a statement’, even given Putin’s calibre as a statesman, indeed as a human.
I’m not doubting that the West (or at least the Anglosphere) might project its war crimes (e.g. the bombings of the two Japanese cities) onto Russia so as to escape any and all accountability. But that wasn’t at all in my mind at the time I wrote my comment the day before yesterday (the 10th).
All in all my belief and hope is that Putin, as an Orthodox Christian, is smart enough to not intentionally harm civilians like the Anglo Allies did with Dresden, etc..
Trying to find the source and confirm this tweet,
“#Ukraine: Head of the Space Agency of Ukraine Taftay: “Kiev will return to the world club of space powers without Russia””
here is the page i got on duckduckgo on the second try: https://duckduckgo.com/?q=%22Kiev+will+return+to+the+world+club+of+space+powers+without+Russia%22&ia=web
😬
First try: https://duckduckgo.com/?q=Head+of+the+Space+Agency+of+Ukraine+Taftay%3A+“Kiev+will+return+to+the+world+club+of+space+powers+without+Russia”&ia=web
😂
i guess the original was written in russian or ukrainsk so i think i must check ukrop msm or ria🤣
Sometimes tweeters suck when they dont link to the articles they quote or refer to.
tweet link.
https://twitter.com/ASBMilitary/status/1424504036515106823
Per/Norway
SA is helping Ukraine probably to be used against Russia.
Military Technical Cooperation between Saudi Arabia and Ukraine and the weapon systems offered for JVs
Hypersonic cruise missile
ukraine tech cruise missle
The Ukrainian design is a high-speed missile with a hypersonic, direct air-jet engine capable of operating both solid and liquid fuels. At the expense of the start-up unit, the cruise missile gathers the required flight altitude of 30-40 kilometers, where the environmental conditions allow the maximum effective operation of the hypersonic engine of the cruise missile.
The operation time of the hypersonic engine is short, but even during this time, the aircraft is able to cover a huge distance. According to data from open sources, The promising Ukrainian hypersonic cruise missile will be able to develop a speed of 1,700 meters per second. The range may be about 300 km or higher (it is worth noting that the technical characteristics of the missil theoretically allow you to increase the range to 1750 km).
Specialists are already actively developing new supermaterials that can withstand temperature differences and high loads. In conditions of hypersonic flight, some elements of the rocket will be exposed both to the effects of ultralow temperatures and to the heating of the melting point of the metal. The use of modern composite materials will provide high-speed and, most importantly, highly maneuverable missile flight
https://defence.pk/pdf/threads/military-technical-cooperation-between-saudi-arabia-and-ukraine-and-the-weapon-systems-offered-for-jvs.719622/page-2#post-13267530
“Kiev will return to the world club of space powers without Russia”
By launching couple of oligarchs suborbitaly?
”Kiev will return to the world club of space powers without Russia”
I feel disposed to believe the Ukro garbage views itself as a space power — being a satellite of International Zionism should qualify accordingly. Literally, the sky is the limit!
FAO Website Principal
“But my point is this: why do Russian officials, who know that Russia has truly effective meds against sars-cov-2, still all advocate for vaccinations?”
As you will know the RF is surrounded by CIA and “Reich” funded biological weapon facilities.
The RF produces a better product at a better price than the western cartels.
Many of us would readily accept the RF product apart from the mRNA product.
We are NOT ALLOWED to choose the RF product because REICH HQ is “miffed” because they are outflanked.
For the record this office regularly trashes the Sputnik WA DC management because they are terminally uninformed about the basics.
They were informed today that human biology has not changed since 1972, and the standard of education in the west has changed.
Today we get a wealth of “social scientists” who are driven by petty ideology.
Back in 1992 the idea was to introduce “newspaper science” to trainee teachers, on top of very restrictive “National Curriculum”. So basically the system was, how can we say, totally FU’ed.
The same applies in the USA and across western Europe. That is why the RF in now a very long way ahead in technology.
For example: a very large well known German company was attempting to connect a 600V DC city tram system to the mainline railroad system rated at 25kV AC.
When the responsible manager was challenged it was resolved that he had BA degree in history.
He could write nice essays, that’s all.
Now I am sure you can see the situation. The RF pharmaceutical industry is not the issue.
The issue is the complete incompetence of western “professional actors” most of whom are frauds.
Why be kind to them?
Regards Luka
I could list “The Sage” “academic papers” used to justify the “quackademic” method.
That would cause a real stir amongst the cohort of “esteemed experts” (the teachers who teach the teachers.)
You have my email. Everyone else can do their own research.
Ask and you will receive Sir, website principal only.
Regards Luka
A One Such As You
Of all the people I’ve ever met,
Of those I remember and those I forget;
Of all the friends and companions true,
I’ve never met a one such as you.
Of all the lovers I’ve ever loved
Of burning angels and mourning doves,
Of those that stayed and those that flew,
I’ve never loved a one such as you.
Of all the voices I’ve ever heard,
Of ancient bards and throats of birds,
Of the eagle’s cry and the lion’s roar
I thrill to none as I thrill to yours!
Of all the foes I’ve ever fought,
Of noble duels and cruel sport,
Of those that lived and those I slew,
I’ve never fought a foe like you.
Of all the dreams I’ve ever dreamed,
Of all the wild and crazy schemes,
I never dared to dream it’s true…
I’d ever find a one such as you.
Dimitar
An “upmarket neighbour” decided to put up a bird feeding station.
The “collared doves” arrived. They were in heaven. Easy food all around.
They ate the eggs of our house martins, who come all the way from Africa
Then they set about the eggs of our blackbirds, then our thrushes.
Then our very well educated professional neighbours claimed “rats were running across their garden” from our property.
The rats were, in fact, our lovely field mice who had lived peacefully in our 150 year old dry stone wall for many decades.
So the local rodent guy was called and he laid the rat poison bait, and we said good bye to our lovely mice.
The doves are not exactly very nice birds, they do a lot of copulation, they love each other, but they ain’t civilised to other creatures.
Regards. An annoyed Luka
“Behold, I am sending you out as sheep in the midst of wolves, so be wise as serpents and innocent as doves.”
I’m guessing the “collared doves” were not the doves Dimitar had in mind.
We have both serpents and doves locally.
The doves do far more damage than the serpents.
Essentially the type of dove we have are “airborne thugs”
Regards Luka (annoyed)
Dear Luka, as long as we ‘eat, sleep and procreate like zombies’, we will be a destructive burden on Mother Nature. The conscious man, however, becomes a sanctuary for all of God’s creatures, in whatever world he may find himself. Otherwise, I weep for the field mice, etc. with you Blessings, D.
Dimitar
Well there a bunch of people who would agree with you. Most of these people have the tickets to the under ground shelters.
In the last “blood letting” 1938 to 1945 we lost how many? In the RF alone we lost what? 25 million?
The Nazi murdered 16 million as slave labour, average life of 6 months.
This time around the “boot” as it were is on the other foot.
When the dust settles the UN will be reformed.
Now Dimitar: “procreate like zombies”, please clarify.
So you are of the opinion that the time has come for a “culling”?
Or maybe you want to sterilise all people so they cannot procreate?
I must caution you Dimitar you are on “thin ice”.
Go further and you will be in a hole, in the middle of a Siberian lake, all alone.
Which helicopter service will you need?
How long will you survive in water at around freezing point?
Are YOU worth rescuing?
Regards Luka
Luka, I started with a poem, I replied with a few lines to your story. I’m not about to offer opinions or cross swords with you over something else entirely. As for your concerns, please start a new thread. It’s taken away entirely for the spirit of the poem.
It seems people often accuse different people of being in a state (of mind or being), that the accuser is actually in, in this case “thin ice”, so this tells me that the accuser is actually on thin ice (about something or someone), ergo the explanation for the offensive reply. The poem was creative and timely, just not for Mr. K-9.
Dimitar
We accept to differ.
Regards Luka
Alas, yes, the human population is steamrolling over the rest of creation. If women the world over actually did have control over their own bodies the world population would not have reached 7.8 billion. Even now, at this state, the 49% who don’t have uteri are calling the shots on the 51%.
Even in Hell, if you are with me,
I would not want to leave.
And if I find myself in Heaven
without you, those wide fields will
be confining to my breathing-heart.
Rumi
🌿🌿
There are many more worlds
beyond the stars
As well, there will be more tests of passion
These expanses are not devoid of life
For there are hundreds of other journeys
Do not be contented by the colour and scent of the world
For there are other gardens and refuge
Why grieve over a lost home
Sigh and lament somewhere else
You are a falcon your task is to fly
Then fly freely in all the incomparable skies
Why remain entangled in daily affairs
When you can during this time be elsewhere
The days have gone when I was alone in gatherings
For now many confidantes share their secrets to me
– A ghazal by Allama Iqbal
☘☘
Very nice. Thank you, Sudhi.
I weep
I sleep
Find tears on my pillow
I’ve wept in my sleep.
Who knew the price of freedom
Could be this steep?
I look around at my fellow sheep
My own counsel, tis better now to keep
The fear, it surrounds me,
And into my psych it does seep.
Incredulous, I watch the mission creep:
Just, Two Weeks to Flatten the Curve
Oblivious, already we are in too deep
Every month a new logical leap
Trust the science! trust the science!
HaHa. You are all now damned to hell!
The price demanded is complete compliance!
Silence!
There will be no WrongThink or defiance.
I want to drive to the beach
I’m locked down, its out of reach.
Obedience to insanity they succeed to teach
Only the vax can save you,
You will comply, capiche?
I sigh
I moan
My soul is heavy
With this feeling, I know I am not alone
I hear on the grapevine we’re observed by drone
One who called me a conspiracy nut, wants to atone
I am living, haunted by freedom’s ghost
Reminiscing of days by the sea
Catching waves, the sun, the glee
Or a walk in the bush, camp by a tree
Now I am held captive, obliged to take a knee.
Do I kneel, submit, go quiet
Or do I rebel, try to fight?
Where do I hide
To where do I flee?
How can this be happening to me?
A child of the wattle
A nation once proud to be “young and free”?
Back to childhood my thoughts do float
Back to the farmyard, the geese, sheep and goat
With grass, water, shelter, they were content
But when it was time for sale or slaughter,
My father did not bother to seek their consent
I have a feeling, a sense, a portent
The powers that be, will never relent
And to hell I am about to be sent.
How can it be
That to once again swim in the sea,
I must first surrender all autonomy
Over my anatomy?
To resist invites ignominy
When and where did so many obtain their lobotomy?
I cry I weep
I seek solace in forgetful sleep
I wake to find my dreams have died
The nightmare is real, all have lied.
Grieve my freedom lost. Now so tired.
The heart that’s free will always be,
Secure in peace and dignity
This world is one thing, the heart is another
Within oneself the Truth we discover
weep for what you’ve lost
but give praise for what you have,
yesterday is gone
WW… every word resonates in my soul.
Cheers from Newie in lockdown NSW
This poem I will put in a frame an keep on the wall!
Thank you!!
Sing!
Sing it loud, sing it clear!
For while there is tune, the ears will listen.
Worry about you and yours enough to not get empty handed, but not more. For tomorrow as yet to come.
The day is today.
Sing!
The day is today, and the moment is now,
It comes but once and then it’s gone…
The wheel of fate is ever-spinning. Whoever is in in the humbleness of succession
will become witness of the gradual shape of style …
White Whale,
Thank you for your poignant poem.
a town descending unto darkness
requires but one lamp
for thousands can illuminate
through just one lamp
become the lamp,
illuminate the town
In the last Cafe I dropped a link to ominous developments in highly vaccinated Israel concerning the effect of vaccinations, they don’t seem to protect that much anymore:
https://twitter.com/RanIsraeli/status/1423322271503028228
The obvious reaction is to introduce a third jab. They actually started, but the first signs are that it doesn’t help either:
https://www.timesofisrael.com/tv-14-israelis-who-got-3rd-shot-later-infected-with-covid-19/
What to do now? I don’t know. The problem is that we are part of a society, wherein our beloved leaders are still obsessed with vaccinations, and are introducing a witch hunt on unvaccinated (the new ‘untouchables’, the ‘Divergents’).
Here in Germany they even did a ‘test’ in closing supermarkets for unvaccinated. Scary, isn’t it?
Original: https://journalistenwatch.com/2021/08/09/nur-einlass-geimpfte/
Translated: https://translate.google.com/translate?sl=de&tl=en&u=https://journalistenwatch.com/2021/08/09/nur-einlass-geimpfte/
That’s the choice: do you want to continue to have a life in health, not-infected, not ill, but barred from society? There have been reports about a Canadian woman barred from entering Canada, even with negative PCR test and a doctor’s document with proven antibodies test.
Only with a vaccination certificate one could enter.
Than it’s not exactly about ‘health’, is it?
I’m wondering how many years it will take before we will be are asking ourselves what the hell we were doing right now.
Stay safe and healthy, cheers, Rob
Appreciate the reports from Germany.
It may not have to take years to ask ourselves this question, as it is more what has happened in the last hundred or so years, what the hell were we doing during all that time that has led to where we are now ?
Even the rivers of blood from wars, terrorism, natural catastrophe’s, has not been enough to awaken minds to think and act to damn up the oncoming tide of world events.
I don’t know if you are a spiritual or religious person, but the Russians used to know about truth and its power, and coined this in their proverb, ‘one word of truth outweighs the whole world’.
Christ said ‘..if you have faith the size of a mustard seed, you will say to this mountain, ‘Move from here to there,’ and it will move; and nothing will be impossible to you.’
That has something to do with the freedom of inner conviction and truth, and much with the hatred against Russia, so, best plant a mustard seed in the west today in support of Russia … I’ve just planted mine…
One of the biggest topics about the USSR is why it fell. And everyone assumes that the USA is the strongest country in the world. But what if the USA had been invaded in WWI, had a civil war between reactionaries and revolutionaries, been invaded by multiple countries during that time, then invaded again with substantial backing by external corporate and banking interests, undermined from within, and then subjected to relentless propaganda, sanctions, sabotage, threats for its entire existence since 1917?
Instead of looking at the failure of the USSR, it’s kind of miraculous that it lasted that long given the entire Capitalist world worked for its destruction.
And everyone criticized the USSR for being repressive. Given its internal and external enemies, compare the repression going on in the West, with none of the external pressures the USSR faced, is it really so surprising that the USSR was ‘paranoid’?
Even paranoids have enemies.
Sounds like the West Balkans today.
Sarajevo assassination, started WW1.
NATO and The European Fourth Reich murdered around 100 000 souls not long ago.
A fabulous part of Europe, totally torn apart.
That takes a few of us to the Ustase Cult during WW2.
Note to the principal of this website; you want to re-write history in real time?
Regards Luka
I forgot to mention that, while many countries invaded the new Soviet Union after the 1917 revolution, during the USA Civil War in 1861-65, Britain and France supported the slaveholder South but did not invade. Had they, there probably wouldn’t be a USA today.
Moreover, the reason they didn’t invade was because Russia was the ally of the USA and sent warships to guard US ports. Yet the US invaded Russia. And continues to threaten it. A real pity.
subhuti37
The RF is constantly baited by the NATO-Brussels EU Fourth Reich Nazi Alliance.
The contemporary malintent toward the RF began in June 1945, if not before.
The threat to “western global public well being” comes from another alliance of “bad actors”.
Regards Luka
This is Kafka like, poor guy, how scary
https://libertarianinstitute.org/articles/american-justice-innocent-man-kidnapped-drugged-and-caged-in-mental-institution-for-years/
For all of those that do not know yet. New rule … the last sentence of this one is applicable to the Cafe and I bold it. I think it is the only change.
19) New! I am banning any comments which mention, even indirectly, the medical aspects of SARS-COV-2/COVID19 including, but not limited to: origin, prevention, effects on health, treatments and putative “non-existence” (including the “its just like the flu” kind). However, I am specifically ALLOWING comments about the political, ideological, social and economic aspects of SARS-COV-2/COVID19. Any attempt to “smartass & bypass” this ban will result with an immediate removal from the infringing comment. A second attempt will result in a permanent ban.
The “Cafe exception” has now been canceled and this rule applies to the entire blog!
20) New! Okay, I am fed up with all this idiotic “there is no pandemic” nonsense. So, from now on, any post denying that there is a pandemic will be removed and its author banned.
—————————
Thank the heavens and high time! I truly hope the moderators are like Piranhas or Kalashnikovs on this one.
—————————
So, on the community site, this kind of work will be welcome:
– The Leprechaun’s valuable contributions from sis,
– Work such as the TCM guidance which is well-sourced – https://saker.community/2021/06/29/the-power-of-tcm-traditional-chinese-medicine/,
– Serious and well-sourced alternative protocols, Ayurveda, Unani, Siddha,
– And pro and con debates on these based on sober assessment.
—————————
Are we going to see some comments on the political, ideological, social, and economic aspects? A new conversation is necessary.
Now for the third time – please I ask you Russian speakers again.
April-June one of the top directors (head of Russian counter intelligence ) at the http://www.fsb.ru quite
clearly stated in a Russian TV interview that this whole xxxx is hybrid ABC etc, from most possibly USA.
English sub-titles…
My Russian is pathetic and focussed on reading agricultural-climate issues.
Must be recorded on their press releases http://www.fsb.ru for 2020…
Checked the http://www.fsb.ru and it is DEFINITELY not the present younger looking CEO/director on their home page.
A more elderly gentlemen with a very curt, rough voice — guess he was understandably pissed off.
All this polemic about this topic xxxxx is becoming tiresome and exactly what CIA-Deep state want – hysteria, break-down in trust and continued confusion and conflict!!
Get real dear reader – US has got at least 13 plus Bio-labs, some in Diplomatic compounds others medical centres etc., around the Russian borders.
Finally, as an ex-Rhodesian-South African 1960-1976, it was discreetly acknowledged their was close co-operation between Pretoria (government and private), Tel-Aviv, London, USA to develop and test in the field all sorts of nasty microbes on the darker members of society.
Not just French-Israeli-hardware etc., Mirages-Kfirs, subs, super-artillery etc.,
Those 4 Ashkhazani nukes delivered in 1976…
After so called independence 1990, South African entities clandestine, rogue or otherwise, carried on with experiments and field *testing* in neighbouring states.
Whatever – now USA has almost legislated for military service registration for women at 18 –
2021 and 2022 are going to be very, very messy and unpleasant..
Amarynth,
In India, The Ministry of Ayush is dedicated to Ayurveda, Unani, Siddha and Homeopathic medicine which regularly recommends remedies not only for SARS COV II but also for other diseases, for example, Ayurvedic medicine – Ayush 64; Siddha medicine – Kabasura Kudineer; Homeopathic medicine – Arsenicum album 30, have been recommended by the Ministry –
https://www.mid-day.com/news/india-news/article/ayush-ministry-launches-distribution-of-ayush-64-kabasura-kudineer-23172298
https://www.schwabeindia.com/blog/homoeopathy-in-general/360-what-is-arsenicum-album-and-what-does-the-ministry-of-ayush-have-to-say-about-it
Can we then post such articles on this Cafe ? Moreover, according to the Indian Council of Medical Research (ICMR) around 70% Indians have been infected and developed antibodies against Covid 2019 –
https://www.google.com/amp/s/www.livemint.com/news/india/these-states-have-over-75-seropositivity-icmr-s-national-sero-survey-finds/amp-11627468536788.html
The Indian government has also assured every person will be given free vaccinations against the disease, so there is that.
Hi Sudhi,
No discussions on the health aspects of Covid will be tolerated, is my understanding.
Political, ideological, social, and economic aspects may be freely discussed.
Thanks for all your wonderful information but we should take it across to the community site from now on. Just let me know if you have anything. There is more than one medical system in our world as you and I well know.
A new and revised IPCC report has arisen, and already many people are shouting something like ‘told you so’ about some conclusions without going into the details. What is the difference compared to former reports? Have the same calculation models been applied? Are we talking about ‘worst case’ or ‘most probable’?
Without going into technicalities, let me highlight a part of this first report analysis:
https://www.tichyseinblick.de/kolumnen/klima-durchblick/klima-horror-modelle-mit-extremszenarien/
(point 2, yandex translate): “Nevertheless, the holy grail of climate research, climate sensitivity ECS (temperature increase with doubling of CO2) has been raised. So far, the IPCC expected a range of temperature increase from 1.5° to 4.5° Celsius with a doubling of the CO2 concentration from 280 ppm (1850) to 560 ppm in the future. Against the background of the new models, the IPCC now specifies a temperature range of 2° to 5 ° C, with a narrower confidence range of 2.5 °C to 4 °C. The Climate Council even dares to give an average of climate sensitivity, namely 3°C for a CO2 doubling.”
Maybe it’s the best we have. Still, concerning the absolute truth with which it is ventilated in the press, I’m thinking whether we would accept these uncertainties in price and capacities when acquainting a house or a car.
Talking about houses.
Let’s have a look at the houses of the primary czars of global warming fighting.
This is the house of Obama at Martha’s Vineyard, Massachusetts, USA:
https://ibb.co/gjDFQbJ
And this is the house of Al Gore at Santa Monica, California, USA:
https://ibb.co/18CMgQY
Mmmh, I wonder. For themselves they seem to care zero/nada/null/niente about the dangers of sea level rising, do they? ;-)
Cheers, Rob
An excellent review of the IPCC and related, on yesterdays UKcolumn,org with the usual factual, highly intelligent, straight forward delivery one expects now from them
Well, it looks like reante got his definitive answer. He has today to live in pure Reason at MFC.
The horror lol. If it wasn’t mundane to us greybeards of Collapse it would be surreal. I remember my brief stint at MoonofAlabama, what a poor analyst B was. The man couldn’t see straight. Unz I have no beef with, he’s just a square. Not a man to hitch your post to unless quantity over quality is your thing, or an agoraphobic closing of ranks is in order.
Mr P,
you seem like a real man of character, and of humble leadership, and like you have a fair bit of time on your hands, and more than enough savvy.
Would you be interested in starting up an alternative space, an open one, where whoever here wants to can continue talking through these times together, continue building together, in creative tension? That would be the natural evolution.
Or at least facilitating its beginning that someone else might volunteer the time to manage. Myself I have in mind a minimalist platform that requires as little structure and thus maintenance as possible but then again since I am categorically unqualified to carry out such work myself what I have in my is neither here nor there.
This suggestion obviously applies to anyone here who might want to facilitate this. Mr P came to mind because of the principle behind the saying, “if you build it they will come;” Mr P has built an impressive body of work here at MFC that has the momentum to carry the willing out into a open field of dreams over yonder.
For your consideration.
And thank you Saker, for the fair and clear warning that we have one day to tie up any loose ends that we may choose to tie up. We appreciate you valuing our dignity.
Thank you to the mods.
reante signing off…
Well reante,
my reply, for one, never saw the light of day – and that before the latest censorship pronouncement..
I’d request amarynth to share my email with you but since she once wished to doxx me, that won’t fly.
Good luck friend – I think we’ll need it.
Here. https://www.zodlikeproductions.net/f1-main-discussion-hlavni-diskuze-english
You can start your own thread/topic, very lightly moderated. Invite friends etc. Post pictures, videos, comments.
Friend of mine. Working the trenches for years now
Kent
Dear friend, you’re an enrichment to the MFC. Consider that as opposed to what might be considered an affront to your personal freedom. Best, D.
Why do all the governments run to vaccines instead of treatment when only one percent of the population is affected?
The biggest distinction is price. Vaccines are much more expensive and less effective than simply getting ill and recovering. Ivermectin is less than one dollar a day in many countries. Koronavir treatment is some 12’000 RUB the last we heard. Here in Switzerland, a friend who is a transplant patient and cannot be vaccinated told us that Ivermectin had been removed earlier during this crisis from pharmacies across Switzerland. We recently received news that one pharmacy in Geneva has been able to restock it. There may now be others.
This is a giant, global experiment with no control group, no mandatory reporting. The data is handled with a four to six week delay. No informed consent can be given without accurate statistics. This is a direct violation of the Nuremberg Code.
In addition, numerous countries have eliminated any requirement or possibility to have an autopsy done.
How many points does the current situation violate of the Nuremberg Code?
The voluntary consent of the human subject is absolutely essential.
This means that the person involved should have legal capacity to give consent; should be so situated as to be able to exercise free power of choice, without the intervention of any element of force, fraud, deceit, duress, over-reaching, or other ulterior form of constraint or coercion; and should have sufficient knowledge and comprehension of the elements of the subject matter involved, as to enable him to make an understanding and enlightened decision. This latter element requires that, before the acceptance of an affirmative decision by the experimental subject, there should be made known to him the nature, duration, and purpose of the experiment; the method and means by which it is to be conducted; all inconveniences and hazards reasonably to be expected; and the effects upon his health or person, which may possibly come from his participation in the experiment.
The duty and responsibility for ascertaining the quality of the consent rests upon each individual who initiates, directs or engages in the experiment. It is a personal duty and responsibility which may not be delegated to another with impunity.
The experiment should be such as to yield fruitful results for the good of society, unprocurable by other methods or means of study, and not random and unnecessary in nature.
The experiment should be so designed and based on the results of animal experimentation and a knowledge of the natural history of the disease or other problem under study, that the anticipated results will justify the performance of the experiment.
The experiment should be so conducted as to avoid all unnecessary physical and mental suffering and injury.
No experiment should be conducted, where there is an a priori reason to believe that death or disabling injury will occur; except, perhaps, in those experiments where the
experimental physicians also serve as subjects.
The degree of risk to be taken should never exceed that determined by the humanitarian importance of the problem to be solved by the experiment.
Proper preparations should be made and adequate facilities provided to protect the experimental subject against even remote possibilities of injury, disability, or death.
The experiment should be conducted only by scientifically qualified persons. The highest degree of skill and care should be required through all stages of the experiment of those who conduct or engage in the experiment.
During the course of the experiment, the human subject should be at liberty to bring the experiment to an end, if he has reached the physical or mental state, where continuation of the experiment seemed to him to be impossible.
During the course of the experiment, the scientist in charge must be prepared to terminate the experiment at any stage, if he has probable cause to believe, in the exercise of the good faith, superior skill and careful judgement required of him, that a continuation of the experiment is likely to result in injury, disability, or death to the experimental subject.
[“Trials of War Criminals before the Nuremberg Military Tribunals under Control Council Law No. 10”, Vol. 2, pp. 181-182. Washington, D.C.: U.S. Government Printing Office, 1949.]
“The Saker – Blind Loyalty, Disguised as Defiance”
Hillarious!, But.
https://euvsdisinfo.eu/the-saker-blind-loyalty-disguised-as-defiance/
Kent
Kent, you win, you can’t leave us, I have tears running down my face, freakin’ hilarious. If any single person that has ever posted in the MFC doesn’t check this out…pricelessly uplifting…lol.
Cheers, M
I wanted a good laugh and so I took a chance on a link I was not familiar with (rare for me). I even forgot to use Sandboxie.
The read made me reflective. I could see myself believing every word of it if this were several decades ago.
It begged the question, where I am now in my outlook and beliefs, have I just drunk from a different koolade?
I am not Buddha-enlightened. I am going to err, I am going to experience pride in my beliefs *again*, it is inevitable.
RBG said something, “there are no evil people, only evil ideas”. Most rules have exceptions, this one has glaring ones, but I find it important in shaping my outlook. The Nazis weren’t a special type of being that descended upon Earth and then were wiped away. They were made of the same stuff all of us are. All of us.
We have to judge our own ideas and beliefs and be watchful. And then do it again, and then repeat until it becomes a habit. Habits over time become character.
But then pride returns and one imagines that now that I am watchful I am protected from error and evil ideas.
Thanks Kent,
A quote comes to mind –
“I’m not upset that you lied to me, I’m upset that from now on I can’t believe you.”
― Friedrich Nietzsche
These guys have not only lost their minds, This is nothing but a hail Mary, but it does prove there are multiple shortages of materials when it come to the big ramp up to 50% electrically driven cars by when Uncle Joe? 2030??
https://www.rt.com/usa/531686-bezos-gates-greenland-mining/
“The ‘Moveable Feast’ is an open thread where readers can post wide ranging observations, articles, rants, off topic and have animate discussions of the issues of the day.”
Nope. Not anymore. The quiet sanctuary is now dead in it’s (intended?) original form. The restrictions on liquors and wine in this Cafe’ are now extended beyond belief. One brand of whiskey and one choice of wine decided by the owner.
Where is the shitstorm after the latest restrictions?
I see scared people treading very carefully to avoid being banned from this beautiful place. I’ve seen people come and go for years (many). Most do not return. Banned or just moved elsewhere for whatever reason. I don’t know.
As for the latest topic that is now prohibited. I haven’t really commented on that previously. I do however, tend to agree with Ron Unz on his conclusion in his very extensive and in depth researched article last week.
That, in itself is not at all satisfactory to me, as the spiritual dimension is not part of his equation, neither is some of the more obvious (to me anyway) underlying reasons for the apparent desperation in unleashing Bio-Weapons this late in this particular game.
In my own research on this issue I have had tremendous pleasure in reading ALL comments on this blog, from sincere sleuths with variable but extensive skills in a large variety of fields. (Saved me many hours of work)
The 3 open threads IMO, and contrary to The Sakers view, was, and still is the best ever on a very serious issue on this blog.
So, what to do?
Regardless of reasons, for a series of restrictions during the last years, (and believe me, I have considered, and speculated on quite a few scenarios, many hours actually) I feel that I have no choice but to leave.
Has been an interesting experience, and I thank you all from my heart for the knowledge you have provided, your spirit, the awkward moments, the fun, the poems.
So, Brothers in Arms.
Goodbye, and thank you for ALL the fish.
Kent
Hi, Kent,
I do understand you decision.
One can’t have it both ways, can one!
Katherine
Dear Kent.
I have long appreciated your posts….your pics, your links to music and your comments.
We are all adults here. Mature. With life lived experiences from such a range of countries and circumstances.
So of course, I acknowledge and accept your decision is yours, but….I really do hope you’ll reconsider.
I don’t think I often responded to your posts, but I always read them. Always valued them. ~One of my personal “rules” is to resist being “that guy” who replies and comments on
Every
Single
Post.~
We’ve seen a few blatherskites* come as go over the years, and some avatars I am really pleased to no longer see.
But you, Kent, I genuinely will miss your input.
Rather than leave, I think what is needed is for us, the long timers, (and some of the newer visitors), to keep posting, to keep observing, to keep the shared insights available.
We know there is nowhere else exactly like the Saker blog, nowhere like the MFC.
Yes. The moderation guide rails are growing narrower.
But we are so blessed that Saker sees fit to offer this digital hospitality.
There is no “free” speech anywhere ~ not on twitter, nor on faecesbook or utoob, or anywhere. If I had a “social” account, I’d try this experiment: Take a single post from Saker’s blog, and see how fast it’d get me banned on Twitbooktube.
The moderation here is clearly articulated. And the logic explained. Seeing the cacophony on some less moderated sites, well there is a reason I (and others) choose here as our digital “home”.
Also, I do have concerns for Saker…. this site looms large in the geopolitical discussion space, precisely because it is independent and beyond “control”.
He was a guy who followed the “build it and they will come” philosophy. And here we are.
Some cafes have 150+ comments and some 5000 views.
That’s a hellava lot of eyeballs on the sidelines.
And the cafe is influential. Some time back (2020) I wrote a post….and about a week later saw my words plagiarised in a most intriguing location. And no, I’m not going to elaborate.
How do I know it was me?… when you write something, you know your own work. Along with being equal parts insult-flattered, that’s when I realised the power and potency of this site.
So, if you can, Kent… please stay, and please continue to help us all do our work in words and spirit, in keeping our collective thumb on the scales that weigh for peace in our world.
WW.
WW you are a farmer of words. Changing mind sets adding to the lexicon, it’s no easy feat. I’d be flattered were someone to use my ‘words’…..I suppose as long as it doesn’t cause loss off income, flattery should be taken as such. Now music, dear lord, that’s an entirely different, copywrite vulture, subject.
Cheers, M
How many people are still on here from say 5 years back? Where is Auslander, has he gone quiet? Serbian Girl? Pity you are leaving, Kent.
Should have a roll call, lol.
Why be for or against anything? Or better still, why not keep those opinions, beliefs and or conclusions/evaluations to ourselves?
For me, the best answer is it makes it a lot easier to get on with the next person.
Within each of us is a storehouse of knowledge, wisdom and truth accumulated through many incarnations as a unique spiritual being – the Diety made us all unique and loves us all equally – why not draw on this to share,
why not look for and share the common thread in all human experience?
only disagreement
from within can divide an
otherwise strong house
a split mind rings
like a cracked bell
Poetic Justice
You may be young, you may be fine;
The heir apparent, the next in line.
When all’s said and done, it’ll be up to you,
Should poetic justice make a change or two.
You survived the fall and the apocalypse,
With the richness of heaven at your fingertips.
You’ve been blinded, sidewinded, and set in a spin,
But poetic justice is in everything.
It’s in how you think and in how you feel,
It’s in what you earn and in what you steal.
It’s in what you give and in what you take
Poetic justice makes no mistake.
You may be the king, the lord of the keep,
You may be the beggar that sleeps in the street.
You may be the face that launched a thousand ships;
Poetic justice writes all the scripts.
It may grant you a kingdom, it may grant you a crown
It may lift you right up, or bring you right down.
Whatever the price, you’ll be back for more,
Poetic justice always keeps score.
And then one day when you’re finally done,
You lay down the struggle and cease to run,
You beg for love’s touch and its wings to fly
And you bid poetic justice goodbye!
You may think it unkind, you may think it unfair,
That poetic justice is everywhere.
You may think you’re a player, that you love the game…
To poetic justice it’s all the same.
Cécile Corbel; Bran
https://www.youtube.com/watch?v=ApbCXyT13Gk
Very true, there is an old hindi adage –
Wisdom increases through sharing
Dear Saker,
If I had to read 1-3 Russian websites for news, including Covid-related information, which would you recommend? I can read Russian, I just don’t really know the lay of the land other than that Cohen always recommended Novaia Gazeta.
I will also say that in March or April of last year when questioning what was going on, I came to the conclusion that if Russia & Iran were on board, then it had to be real.
First, I was also initially inclined to believe the Iranians (‘biological warfare’). Also, which is another example of Russia still being half-corrupt, in my humble opinion Cohen was an outrageous (Trotskyite) fraud.
But ‘biological warfare’ doesn’t work, at least not in normal circumstances. Nature knows best (The Saker’s Mansoureh Tajik), not a bunch of bungling charlatans. If there’s no threat from nature (in normal circumstances), then there is no threat.
The pernicious influence of (the satanic ideology of) “Western medicine” (e.g. germ theory) has corrupted medicine worldwide, for decades and centuries.
. . . [as for the germ theory; bacteria can be dangerous, but only in very unfavourable circumstances. For instance when received in very large amounts and/or when one has little resistance. ‘Viruses’ do not even exist] . . .
The medical policy of the leaders of countries like China, Iran, and Russia is the consensus of their semi-corrupt medical system.
I know 8 people that have had both covid shots my father and my wifes aunt are both dead from miny strokes my friends wife lost her baby still born was hEalthy at check up day before she got her shot cousin 18 needs heart transplant other 4 no side effects needless to say iwont be getting vaccine.i dontbelieve this makes me a anti vax nutcase as saker implies just prudent
Me neither. I just recently had a tetanus shot.
(bacteria do of course exist, and some could be dangerous under very unfavourable circumstances. But there’s a lot of very exaggerated scaremongering by the usual suspects there too)
Saker, I just want to quote you here as this is important information:
“Speaking of Russia: keep in mind that Russia has at least one very good candidate for anti-COVID meds: Koronavir (see here for a machine translation of the details about this med). This is an extremely effective drug. According to Russian scientists it reduces the viral load by 80% overnight, even in very severe cases! A friend of mine almost died from the sars-cov-2 and I sent her that medicine with overnight shipping. She later told me that she felt better as soon as she took her first does (full treatment is 50 pills). Of course, Zone A media will not report that.”
The reason you get so many posts on this issue is that such medications (it sounds very like Ivermectin) are being suppressed as likely effective drugs – there was not proper disclosure for those participating so far in the vaccine rollout, which couldn’t be given status if there were alternative appropriate treatments such as the one you describe above, which apparently Russia has. And vaccinated people in the US and other countries are discovering that not only they can still get the virus, but they have a high viral load and can still transmit it. This is frightening to many people. It also makes the ‘vaccine passports’ useless.
Please don’t take offense. We have an ongoing conversation at MoA on the subject, and nobody is calling anybody names there. It’s a dialogue. So, you are welcome to come there, anyone who has a point to make about this very difficult subject, or a link. We just ask you to be polite, not to accuse anyone of anything. We are all in this together.
at the point where one determine right or/from wrong, one already gave up choices.
… but choices does not always lead to answers, far more to claim it is ‘truth’!
bwbs
The problem, dear friend, is how does man rise above the good/evil, right/wrong dichotomy?
Because as we’ve seen good versus evil has been in a continuous tangle since time immemorial, and neither good nor evil has prevailed.
The answer lies in the directive given by Socrates and others, “Know Thyself”.
dear friend Dimitar, as I am replying to you, at your lv,
we can skip all the bs,
for the answer is One and TheEnd,
one has to be like god or be god, thus hidden in ‘know thyself’
as in the new weather in the cafe lately.
are we not all lil-wanna-be-god, determining what is right/wrong, in our own eyes, in our daily life, then enforce it unto others, just to prove our existence and superiority? as if we can feel our skin (in the game) mor? they call it ‘job’, ‘gov’ even ‘family’. as if we are ‘gened’ to be just that. so natural. unquestioned!
agree? who needs those pretentious good or evil then?!
what problem, sir?
wind blows. wind blows, dear friend :)
dont catch a cold, esp from the ‘dont exist’.
bwbs
“are we not all lil-wanna-be-god, determining what is right/wrong, in our own eyes, in our daily life, then enforce it unto others, just to prove our existence and superiority?”
Well, I’m sure there are many who are ‘enforcing’ or imposing/prevailing upon others, in order to ‘prove their superiority’ etc. but I’m not referring to them in my comment. I’m referring to those who genuinely ‘make it over the line’ to the Self-Realised state. The state of Self Realisation or Self discovery is in fact the destiny of every Soul, and no one establishes themselves in this particular state of consciousness without ‘turning over a new leaf’ as the saying goes. Soul can regress as well as advance spiritually, so everything it does is eventually accounted for. All of this is for Soul’s benefit. None can approach the Deity without the proper preparation, Soul would be burned to a crisp, so to speak.
Yes Dimitar
Reminds me of an encounter our pack had with a young Slav journalist working in Seattle.
She had made a “life decision”, and found herself well received by the N. American upmarket “west coast gang”
As you know old K9 “Luka” is not shy in howling the alarm.
“You realize you are expendable” Luka said.
“I know” she said “we all are”.
Regards Luka
‘Out beyond ideas of wrongdoing and rightdoing there is a field. I’ll meet you there…’
Rumi
ah dear friend… but Rumi is god (he said so himself)
bwbs
p/s anyway I am spending/wasting too much time here… if my theory/idea/experience/truth of ‘longevity is fixed’ then perhaps there must also be a time for ‘thanks for all the fish’ (or was it dolphins? xD
‘Tis the Father within that does these works…
You have to add the rest siljan … it comes alive then :-).
“When the soul lies down in that grass the world is too full to talk about.” Rumi
Siljan and amarynth, Rumi was writing from the Self-Realised state, and this comes through in most of his work, despite the indignity of having endured translation after translation from people who were not working from the same state of consciousness. One of the best Rumi books is The Hidden Rumi, by Doug Marman, from Spiritual Dialogues Project, truly head and shoulders above the rest.
Yeah nah.
Been following since 2013.
Like the site.
The author/s.
Just a magic thing this saker thing.
But I am gone.
Not a nut job.
Not a fanatic.
Am educated and feel could rip Unz and Saker a complete new one but I don’t have the time for it either.
Every person I know who has complied has lost the spark in their eyes and have had personality changes. Attacks right frontal gyrus. If you have had it you can’t here me anymore because the right frontal gyrus is all about the other, theory of mind.
Sorry Saker, I hope you prosper and can keep your health. I wish you the very best.
I have had many names over the years but Wendy has been around for a while.
All the best
Goodbye.
Wendy
“Every person I know who has complied has lost the spark in their eyes and have had personality changes.”
This is very true, i don’t know about gyru’s, only the sound alike, unidentifyable group thing, quite sad. Good fortune Wendy!
My wife’s uncle died within 2 days of his second dose of the Pfizer injection – many long time acquaintances have died recently of heart attacks at ages where they simply should not be dying. Something is amiss.
I am also not a nut job, nor a fanatic, nor an anti-anything (I despise these Orwellian debate killing terms) for not trusting a medical establishment that butchered my father-in-law with an unnecessary heart surgery, destroyed my mothers thyroid with a toxic medication, and crippled an otherwise healthy child of my wife’s closest friend with a vaccine that destroyed the child’s ability to communicate.
I am saddened by the angry rhetoric coming from the Saker at those who simply wish to be left alone and not have a forced medical intervention imposed on them.
I also am gone, goodbye.
I was wondering about things I sense in society that I could not properly put my finger on. But, I’m starting.
Let’s start with a remark of Minister Shoigu of the RF in Ria Novosti about the dangers to society:
Original: https://ria.ru/20210810/ugroza-1745199114.html
Translated: https://translate.google.com/translate?sl=ru&tl=en&u=https://ria.ru/20210810/ugroza-1745199114.html
As I experience it on the outside, Minister Shoigu is not so much of an orator, but when he speaks we’d better listen.
What he said could be true for many societies.
This is nicely described in the monumental work ‘Masse und Macht’ from Elias Canetti (let’s keep in mind that it was published in 1960). I want to highlight an excerpt of the chapter ‘Verfolgungsgefühl’. I cannot properly translate this term, it could be seen as that the ‘Mass’ has borders, but also fears that people on the inside (in the basement) could be less trustworthy.
Original text:
“Das Verfolgungsgefühl der Masse ist nicht anderes als dieses Gefühl doppelter Bedrohung. Die Mauern von von außen werden enger und enger gezogen, die Keller von innen mehr und mehr untergraben. die Verrichtungen des Feindes sind offen und überschaubar, wenn er an die Mauern arbeitet; sie sind versteckt und heimtückisch in den Kellern.”
Translated (yandex):
“The feeling of persecution of the masses is no different from this feeling of double threat. The walls from the outside are drawn tighter and tighter, the cellars from the inside are more and more undermined. the enemy’s actions are open and manageable when he works on the walls; they are hidden and insidious in the cellars.”
This is not easily translatable. What I sense in society as a whole, already for years, is crumbling normal dialogue, increasing emotions, and some kind of hunt on ‘the others’, who ‘must be wrong’ and also could be among us.
In this sense I want to add something. The Saker linked to 2 sources of what is called ‘logic’. I think I know what is meant, I would rather expand the term to ‘rhetoric’. Rhetoric aims to study the techniques writers or speakers utilize to inform, persuade, or motivate particular audiences in specific situations, logic is a part of it:
https://en.wikipedia.org/wiki/Rhetoric
Imho a fruitful discussion is possible without destroying the other’s arguments. Listening to other points of view, exchanging new insights can be just as useful, maybe even more. If I’m not mistaken, in the traditional Spanish culture the first one that loses temper in an argument has lost.
One last thing.
They keep quiet in the background, but I want to speak up.
Let’s keep in mind that moderation is a hard job, I know from experience (not here, btw). Imagine that people devote some hours per week on his voluntarily, the subjects are above standard, and the posts relatively long with often a lot of hyperlinks.
Then it could be understandable, that we cannot write what we want and let the mods search it out? In certain circumstances and about certain subjects we may realize this, and that includes also me. I don’t mean this as criticism, just as attention.
In the meantime, keep safe and healthy.
Cheers, Rob
I enjoyed this thanks Rob. The Verfolgungsgefühl is just translated as ‘the feeling of persecution’, but the threat is truly vague and everything becomes a threat.
This psychologist Victor Frankl created from his experience in camps during the 2ndWW a therapy that he called Logotherapy. He explains:
– Each person has a healthy core.
– The primary focus is to enlighten a person to their own internal resources and provide them with the tools to use their inner core.
– Life offers you purpose and meaning; it does not owe you a sense of fulfillment or happiness.
and further:
Logotherapy is based on the premise that humans are driven to find a sense of meaning and purpose in life. According to Frankl, life’s meaning can be discovered in three different ways:
– By creating a work or accomplishing some task
– By experiencing something fully or loving somebody
– By the attitude that one adopts toward unavoidable suffering
He developed these Logotherapy Techniques
– Dereflection: Dereflection is used when a person is overly self-absorbed on an issue or attainment of a goal. By redirecting the attention, or dereflecting the attention away from the self, the person can become whole by thinking about others rather than themselves.
– Paradoxical intention: Paradoxical intention involves asking for the thing we fear the most. For people who experience anxiety or phobias, fear can paralyze them. But by using humor and ridicule, they can wish for the thing they fear the most, thus removing the fear from their intention and relieving the anxious symptoms associated with it.
– Socratic dialogue: Socratic dialogue is a technique in which the logotherapist uses the own person’s words as a method of self-discovery. By listening intently to what the person says, the therapist can point out specific patterns of words, or word solutions to the client, and let the client see new meaning in them. This process allows a person to realize that the answer lies within and is just waiting to be discovered.
So, tying up with your post, check out the Socratic dialogue – here it is explained in a therapeutic setting but of course, we can all learn to do that.
I always liked this fellow – one of the few psychologists that I kept, after I broke with the field as a whole. It’s of course much bigger than this short explanation.
https://www.goodtherapy.org/learn-about-therapy/types/logotherapy
Is it safe to enter? Has Bhaaa Jhaaabs left the room?
What a spectacular failure of discussion. Bhaaa Jhaaabs is unable to discuss topics of political, ideological, social and economic aspects of Covid.
Bhaaa Jhaaabs have also failed at being true to their slogan: “My Body My Choice”. What became clear is if anyone else made a different choice, the dictator gene moves in and nobody else is allowed to make any choice except the choice of Bhaaaa Jhaaabs. And if you do not accept the ‘Bhaaa Jhaaabs choice’, you’ve sold out, somebody is paying you, you’re part of the New World Order, you’re owned. Bhaaaaaa and Meeeehhhh ….
(Sorry for the disdain .. it is slipping out of my fingers beyond my ability to control).
Fair weather friends, we all have to go on our way. I am still here and you will find me here. This will turn out to be the biggest cleanse ever in this space. The wind blows eh … The scab has been ripped of in no uncertain terms.
We have soul, we have karma, we have the whole world with its own threats and victories that we are watching, we have wonderful writers, good posters and I’m looking forward to rising up after cleanup.
Bye bye Bhaaa Jhaaabs, pretend medicos, newly minted virologists and their virologist dogs, first time and newly anti-jabbers that do not understand a principled approach and nuance is something that they yet have to discover.
In the Zone A, you should all be writing to your representatives and threaten them. You should all be hurrying your own preps to completion and safeguarding yourselves and getting yourselves spiritually agile and alive. Its not that we don’t know that Zone A is going down down down and that the leaders are threatening their own citizens. You could be telling us how you are getting yourselves in a good space to weather this storm. Fighting this blog is just pretense and pretend agitation.
The third rail is right here in this Cafe. Read carefully – you will find them here. For you I am so very thankful and grateful.
dear amarynth… who is doing the agitating and making all the fuss and fighting at this special café ?
certainly, some discussion without censorship could be a positive way to move forwards now… just a suggestion.
sean, to rise above is to stand upright.
There has been, and it will continue for a while longer, a dramatic and highly challenging constellation of the planets… Of course, these times come and go, and vary in intensity as do peoples moods and abilities to cope.
The main drive is for power, and this is very intense, a contraction of energy basically, over a considerable time.
We see it everywhere in politics and social engineering, how it sets out with a will to destroy what is best………
All things must pass however, and above the dark swirling mass of shadow, there is and always will be hope, beauty and goodness. Keep going comrades !
Bruckner, Locus Iste
https://youtu.be/HM8EP-pgVfs
The parameters of the conversation have changed. That’s all. Not up for the challenge, rise above. There is the community page were the conversation in it’s current form may continue. Perhaps it me, age thing, but I find navigating there not as free flowing as the MFC. So not sure if I’m there yet.
It’s not the first time the bar keep blew the windows out of the joint. He owns it. Good job they’re not iconic stained glass:)
Cheers M
I tried to make it very easy sean.
Take a look: https://saker.community/topic/new-chatter-and-jabber-thread-wednesday-august-11/#post-6023
The idea is an unmoderated space – it takes a little work to get there. I have to set stuff in the background that will make individuals unmoderated but still keep the trolls out. Lots of software switches to switch but with a little patience, we can flow just as easily. I help of course, but cannot stand the idea of the work of moderation so there is software to do it for us. I cannot imagine all the permutations at start go but we can ‘permutate’ if people use it. It is individual choices there and I must tell the software how to make it per individual. For example, because trolls always link I think it is set to send anything with a link to moderation. It’s just fiddly.
In general, please be patient here. The mods also have a new dispensation to get used to.
amarynth
OK, clear enough.
The new page has a softer approach, more like a “coffee table magazine”
Meanwhile Luka will look up several definitions of “trolling”.
Established “western mainstream media” is shaken a little.
The new platforms are growing fast.
Thank you for your work.
Regards Luka
Akin to a backroom after hours hang out ….. unlike the cafe which has closed its doors to noisy ones, not all bad, noisy nonetheless.I reckon that the noise will increase exponentially regardless,elsewhere no doubt.
I have been grateful for all the links and research done here in this very cafe by all, because it takes inclusivity, in the true meaning of the word, to better ones worldview.
I look forward to continuing to visit here despite many valuable contributors exiting because of the new moderation policy.
Mostly I visit to read and learn, with occasional comments.
God bless all here
Apparently even after emerging from bankruptcy one holds on to their medical debt in America.
Which is why 1 in 6 Americans are 6 months or more behind in their medical debt payments, this can and has lead to warrants being served to appear before a judge and answer to as how one is going to repay this debt.
So this is the end result of for profit health care? Sweet.
And nothing matters more, then to be in attendance with one’s soul. In the zodiac it’s one third of the 12 signs. And again, in the piece about the lies last week – not any idea of the soul, the bulwark of inner consideration immunizing one against all the other half of the physical outside.
The zodiac gives me the old divine measure of the components, man is constructed from.
The experience is, that consciousness of the components (signs, houses, movers) gives raise to a cool distanced but interested mood allowing own symbolical/physical perception without strange lies looking at man and world.
In this spirit the ‘astromundane diary’ of the 32th week of 2021:
http://astromundanediary.blogspot.com/2021/08/the-two-double-rulers-in-virgos.html
Suggestion to the Website Principal
Obviously we do not have the “enigma machines” and very few of us can parse in morse code.
There may be another solution.
We could employ “The Lincolnshire Poacher Number System”
In brief, we could designate a past edition of MFS and use that as code reference.
There are several ways to encode a message.
Perhaps readers may offer some standard operating protocols that would be suitable.
Of course, most of us could not afford a dedicated soft ware tool to made by specialists.
There has to be a way to communicate sensitive issues.
Perhaps using another alphabet as used by the Greeks?
Regards Luka
The current issues and development of society remins me more and more of certain ideas and reflections an author wrote, whom I hold in very high regard: Stanislav Lem. His work was about theinteraction between technology, humans (and their psyche) and physical reality.
One of his points about technological development and its impact on society was (in “Fiasco”): when there is miniaturization and sophistication in sciences, society cannot distinguish between natural and artificial events.
I think that is one major problem we have these days. And it tears discussions apart, because you cannot prove either way.
In contrast to 9/11. It was a simple event, the only spin the empire could put on it was a major P&R and desinfo campaign.
Is it the incredibly wise or incredibly ignorant that are so boldly assured what the future will bring?
Anyway, good bye all.
Man is caught between an indefinable desire that overwhelms and consumes him inwardly; to come to know, understand and harness the benevolent presence he intuits to be at the heart of life and that is working in his favour, while, on the other hand, he’s a citizen of a society in an external world where any step beyond the expected, the established and familiar, is viewed with suspicion and disapproval.
He’s correct in that he needs to hitch his wagon and harness this force or energy, which he perceives as love,
for his personal benefit, but he forgets or overlooks that there are guidelines or laws that govern life in all of God’s universes and that breaking them brings repercussions. He’s also aware at the same time, of the restrictions that the society he is a part of puts upon him, and his position in that society, exerts a certain influence and that he only has a certain amount of fortitude to “take on the world and win”.
Man’s external as well as internal struggle for survival continues lifetime after lifetime, as he gradually understands and accepts the laws of life and starts working with as opposed to against them. He is ultimately compelled by the Law of Love to live by the highest ethics known to man, thereby creating, maintaining and sustaining life in whatever world he may find himself in, wherever, whenever and however possible. When man lives by “Thy Will be done, not mine”, he finds the secret of the universe at his fingertips. That the Law of Love is everything, that it makes everything possible. He finds that he can be a part of any society while maintaining his personal integrity and that his experience, ie; how he ultimately fares in life begins and ends with him, ie; his own creativity, ingenuity or lack thereof is what is responsible at the end of the day for his condition or circumstances in life.
So the answer to your question would be, that those who are assured of survival under any possible circumstance are those that understand that the benevolent presence at the heart of life is an overwhelming,
unconditional and uncompromising love for the individual, and that this love need only be found within ourselves and lived as per the human heart dictates from within. There would be a mixture of the wise and ignorant no doubt among lovers of every stripe, shape or colour.
Dimitar
A question please.
Luka looked at the “wiki” page about trolling.
Do you regard Luka-The-K9 as a “troll”?
If we agree that tolling is “fishing”, that assumes that Luka may be a “cloaked predator”
Luka has one email address which has been in use since 2001.
He does not use the fancy cell phones.
All audio and text. No TV.
All replies welcome.
Regards Luka
I do not.
It’s your opinion that counts in any case, not mine.
Dimitar
Thanks for the reply.
The “social science” definitions can be perplexing.
Luka does not use any of the popular “social media” platforms.
He is a product of WW2, a first generation cross bred mutt.
From the moment our cousins in Kiev decided to shell the civilians in the DPR and LPR we awoke.
For readers in Austria and Germany.
You may be unaware that your politicians, civil servants and commercial managers have broken NS prohibition law by supporting the Kiev junta.
Reading that law we are duty bound to report Nazi activity to a magistrate.
As it happens I do not have citizenship for Austria or Germany.
Of course the situation in Germany has seriously gone “off the ranch”
A report by RT indicated that the German police have the legal justification to throw citizens around like rag dolls.
Unfortunately the police choose to target the weaker members in the recent protests, on the streets in the cities.
Three generations since the activity of the SA, the SS and the Gestapo was condemned at Nuremberg.
Thankfully we now have the ability to record and document the events.
Many of are waiting for the Austrians and Germans, the common people, to call a halt.
Meanwhile the Brussels crew of “grifters” revel in their own narcissistic hubris.
The “rainbow revolution” was an effective deception.
We must wait for the pendulum to swing itself off its pivot, hopefully without too much damage.
The people who fund the rogue imposters, the tax payers, are mostly unaware.
Many have tickets to the underground shelters, and “life is good” for the “chosen”.
Why should they worry while “the gravy” is so delicious?
Reich HQ appoints the trusted dim witted “senior gauleiters” of the Fourth Reich “Dog and Pony Show.”
Regards Luka
Both are boldly assured but only one is correct
Yum, harvest season, didn’t get to eat the first ripe tomato by end of July, had to wait….oh the wait, till Aug 2nd, a record in these parts 4 to 5 weeks early and a handful of ripe cheery tomatoes taboot . For tomato growers, growers of anything, there are learning curves. Past tomato crops had blossom end rot. It is caused by a soil deficiency in calcium and salt. Big black spot on the tomato bottom, very disappointing. So this year we researched, watered by hand with a powdered milk mix and also watered with an Epsom salt mix and while we still have some end rot, do we every have nice tomatoes this year. The same treatment goes for hot peppers also, and many other veggies.
I remember last year, we went a very long time with no rain, then around this time maybe, amarynth mentioned the rains starting where she is, then it began to rain here…..thankfully .This year, we went over eight weeks with no rain then 1 1/2 inches feel in one day and then we went another 12 weeks with no rain, lots of smoke haze form forest fires here there and everywhere but no rain. We finally got some rain, a good two days, it won’t heal the cracks in the soil, some are three inches wide, but it was needed.
digging new taters’n pickin zucchini in the morrow, free range chicken veggie soup for sup.
Cheers, M
Replied to you here .. I get too excited and start babbling up a storm.
https://saker.community/topic/this-years-activities-in-the-tropics/#post-6029
I am often reminded of the discriminations, privations and tyrannies of war times, and of the Stalin camps, how many million upon million went through all these to perish, how many the survivors returned, but to what ?
Twenty years ago I began to think of this more consciously, as people went about their lives without a thought of any of it, and asked, what happened to all that power of hatred and repression, has it disappeared ?
It never did of course but continued to grow in another form underground, and now is everywhere, once again. Only fear and delusion prevent eyes from seeing this, and there is always beauty, and goodness and truth at any moment, and that is why I shared the link to the Locus Iste above, and have made other comments as anonymous on this thread.
It is also why courage for life endures, and the reason that sub forms of communication will grow and take flight, like silent birds that only those with ears will hear and share, here or anywhere. There is a table here, outside on the street, and the birds will fly down and eat the crumbs left there.
The dark and swirling shadows are the result of fear, and below them people are scurrying about and eking out their existence, whether in financial security or poverty, but spiritual wealth is lacking and creating starvation, only it is not recognized!!
The relentless drive of conformism and of exclusivity lead to loss of harmony and simple originality, and by simple I mean not feigned, but effortless and pure. This is being crushed wholesale, like used and unserviceable cars.
Bear this in mind for the future, and for the present, keep the faith, higher love and better days are on the way!
Used car prices have stablized, but not b/c of supply and demand.
But b/c the consumer has tapped out on their ability to afford the new higher priced cars, preferring to bum a ride for 6 months in the belief that the price will come down by then.
But this appears to be a years long problem rather than just 6 months so the balancing of bumming-vs-affording, promises to be a juggling act of reporting hopes verses realities on the ground.
Just posted to the comm page, will still post sis’ contributions there, some people have indicated they enjoy the content………it’s not always perfect, she’s searching leads, sometimes they have legs, sometimes……….they don’t.
This is a long journey, it’s just starting. Even the wife is in on it, I will post one of her gems there also.
Cheers, M
Perfect. Your link is https://saker.community/topic/new-chatter-and-jabber-thread-wednesday-august-11/
And in a while I’m going to mess with your profile so that next time you post completely unmoderated (unless I screw up and completely delete you which is of course an option too lol).
Next time when I open a new thread, I will put a link to the MFC in the top, so that we can easily go to and fro.
>Sis: some people have indicated they enjoy the content.
Abso-bloody-lutely
Am grateful this content can be accommodated in a side corner/ pocket.
Thanks both Sean leprechaun and Amarynth.
Russia High Treason case. is this part of the “the 5th column” in which an August 1 preliminary process has already begun?
Also from the West Navalny hit with new charges.
https://www.metro.us/russia-hits-navalny-with/
FSB detains CEO of hypersonic systems research company in high treason case
According to the source, the investigators plan to ask court to put Alexander Kuranov under arrest for two months
© Russian Federal Security Service/TASS, archive
MOSCOW, August 12. /TASS/. Russia’s federal security service FSB has detained the CEO, who is also chief designer of the open joint stock company Scientific-Research Enterprise of Hypersonic Systems in a high treason case. A source in the law enforcement told TASS the FSB will ask the court to put the individual under arrest for two months.
“In the process of detective and search measures, FSB operatives in Moscow detained the company’s general director, Alexander Kuranov. Investigators plan to ask the court to put him under arrest for two months,” the source said.
The press-service of Moscow’s Lefortovo court has confirmed to TASS that the investigators’ request has been received but refrained from elaborating on the details of the criminal case.
According to open sources, Alexander Kuranov, is a doctor of technical sciences, professor of the control systems and technologies department at the St. Petersburg Polytechnical University and CEO and chief designer of the open joint stock company Scientific-Research Enterprise of Hypersonic Systems of the holding company Leninets.
https://tass.com/defense/1325159
Exclusive: The “5th column” in the process of being liquidated. [Map “?????? ????”]
July 19, 2021 Editor Editor 30
On Friday July 16, President Vladimir Poutine approved a general plan to “cleanse” Russia’s power structures from “disloyal and hostile elements”. The plan was developed under the leadership of Nikolay Patrushev, former director of the FSB and current Secretary of the National Security Council.
??????? ????????
??????? ????????
This plan was named “?????? ????” (“Only his own”, to be understood as “only ours”). According to the document, there are in the power structures of Russia, up to 15% of elements hostile to the current leadership of the country and favorable to a rapprochement with Western countries. What is commonly called here “the 5th column”. According to the authors of the plan, this 15% are potentially ready to help “hostile forces whose aim is to destroy the country”.
This plan will enter into force on October 1, 2021 and will continue in principle until the end of February 2022. A report will be submitted to the President on the first day of each month, The FSB is responsible for the organization and implementation . Commissions will be formed by October 1 to organize the practical development of operations.
On August 1, 2021, a preliminary process will begin which aims to define precisely according to which criteria the “hostile elements” will be determined, to define the methods used to identify them, and to define the organizational and operational measures. The “hostile elements” identified will be subject to sanctions ranging from dismissal to criminal prosecution, without prejudice to other measures that could be taken if the situation so requires.
There is currently a status quo between the various factions within power: “Conservative” patriots on one side, “liberals” dreaming of Russia’s alignment with the globalists on the other. This plan is clearly intended to put an end to this status quo by eliminating the current second members of the government and of the various federal services, whoever they are. It is part of the perspective of the “great transit”, an expression designating the departure of Vladimir Poutine from the Kremlin. One can only wish its full and complete success so that finally the traitors are eliminated from the Russian political system. The only thing that we can regret is that this operation did not come sooner, in view of the damage committed by this “5th column” for years.
Treason-It is known that the US and China have shown interest in Kuranov’s project.
Russian ‘hypersonic missiles’ boss has been arrested for treason
By Boyko Nikolov On Aug 12, 2021
Share
MOSCOW, BM, ($1= 73.57 Russian Rubles) – Russia has detained the head of the hypersonic technology program on suspicion of treason, the Guardian reports, quoted by Sega.bg.
Alexander Kuranov, 73, director-general of the St. Petersburg-based Institute for the Study of Hypersonic Systems, was arrested in Moscow on Thursday. The court ordered his detention for two months in pre-trial detention.
Kuranov is an expert in hypersonic technology and is leading the work on the concept for a new hypersonic aircraft called Ajax, according to the institute’s website. Hypersonic technology allows objects to move much faster than the speed of sound. The Guardian recalls that Vladimir Putin announced a new set of hypersonic weapons during a speech to senior officials in 2018, suggesting that the weapons could hit targets in the United States and evade missile defense.
Russian state media reported the arrest, citing anonymous sources. “According to preliminary information, Kuranov, who has been working in the field of hypersonic technologies for years, has shared classified information for research with a foreign national,” Interfax reported, citing a source familiar with the investigation. It is known that the US and China have shown interest in the project, the agency said.
Russia: the US doesn’t have the technology to control a hypersonic missile
Russia has not seen much progress in developing the US LRHW hypersonic missile. Russian military expert Alexei Leonkov expressed a similar opinion in an interview with the Russian newspaper Vzglyad. According to Leonkov, titanium alloys are essential for protecting the electronics in the warhead and question the US capabilities for their production.
“But the question is, how will the electronics in the warhead behave when heated to certain temperatures?” Do they have the technology to produce titanium alloys that can withstand high temperatures and overloads? So far, nothing has been heard about it,” said the military expert.
However, Leonkov did not mention in his interview the participation of entrepreneur Ellen Musk. BulgarianMilitary.com wrote in March this year that Musk and his company were rewarded with an $ 8.5 million contract from the Pentagon. The company’s task is to find suitable alloys and materials or develop new technologies to deal with the high temperature during the launch and flight of the hypersonic rocket.
Leonkov also referred to a GAO report estimating the costs of the hypersonic missile program. He quoted a statement in which the GAO said that “the United States does not have breakthrough technology.” In this way, Washington cannot reach the level of controlled hypersonic, Leonkov added. “There is virtually no such technology,” he said.
https://bulgarianmilitary.com/2021/08/12/russian-hypersonic-missiles-boss-has-been-arrested-for-treason/
Galloway on Assange. I have no words for this.
https://www.rt.com/op-ed/531834-george-galloway-london-court-assange/
BREAKING! Kandahar has been captured!
Thread starterAgha Sher Start date50 minutes ago
Reports are coming in – mass retreat by army towards the airport
Please someone tell me that Turkey is in charge of the airport.
https://defence.pk/pdf/threads/breaking-kandahar-has-been-captured.719833/#post-13270772
Where are the Spectre Gunships?
Older model but shows precision.
Youtube is from 2014 and shows actual airstrikes.
https://www.youtube.com/watch?v=hD5CL8714rU
AC-130H Spectre Gunship • Airstrike On Insurgents
The Gunships are to be used with the 52’s and are much more precise. The Taliban are mixed with the friendlies so exact strikes are probably necessary.
http://www.uniindia.com/us-b-52-bombers-strike-taliban-targets-in-northern-afghanistan/world/news/2470954.html
“Drill, baby, drill!” has taken on a whole new meaning:
NASA astronauts reject lie detector test in Soyuz MS-09 spacecraft hole probe — source
https://tass.com/science/1325247
Even after the many, many months of informative comments on the now forbidden topic, all the links and articles, and can reread, one feels the need to read more at the MFC, that it was a link to what is happening now around the world, and as in many of the comments and links containing related info on the sociological, philosophical, economic and political and God knows what areas, they are inseparable from the banned topic, it is an intellectual abstraction to imagine this is possible, and truly, no offence meant whatsoever.
Perhaps there could be some compromise, negotiation of a kind, that the Saker would consider and might help?
I honestly believe that it could be advantageous and for the good of all, to find a workable solution which people feel free with and that functions
My suggestion is to ban or trash comments that deliberately rile others, (I can’t give examples or I would be banned,) that are unhelpful, and do not respect the sensitivity of other’s on the topic. This has generally been the case anyway.
Mindfulness would go a long way, far better to move on.
Something for you, tuppence…
Donovan “Sailing Homeward”
https://www.youtube.com/watch?v=XnjhmoiIXPc
whenever I wander weary
I reach for you,
I know you’ll be there
for to see me through…
Thank you for the beautiful song
II knew it it would lead to nothing, but at least I tried. Sorry I’m not the new yuppy hip grip dope along tribe type. Naturally, life will continue here, same old. Thanks Dimitar, very nice song, Donovan was a legend of his own.
tuppence